LncRNA Gene

ZFLNCG12636

Basic Information

Chromesome: chr23

Start: 29308100

End: 29308405

Transcript: ZFLNCT19516

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR941753 posterior pectoral fin normal 12.20
SRR038627 embryo control morpholino 9.48
SRR749515 24 hpf eif3ha morphant 9.32
SRR941749 anterior pectoral fin normal 7.45
SRR038624 embryo traf6 morpholino and bacterial infection 6.95
SRR1028004 head normal 6.45
SRR527832 16-36 hpf normal 6.39
SRR749514 24 hpf normal 6.19
SRR726542 5 dpf infection with control 6.13
SRR516129 skin male and 5 month 5.94
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC101885379 0.58
napgl 0.53
nr5a1a 0.52
v-fbpl 0.52
LOC101884213 0.52
crfb9 0.51
cldn10b 0.50
Gene Ontology Download
GO P value
GO:0030325 1.28e-03
GO:0021854 1.42e-03
GO:0031018 3.55e-03
GO:0043401 1.08e-02
GO:0009755 1.18e-02
GO:0045944 1.88e-02
GO:0048732 1.99e-02
GO:1903508 3.05e-02
GO:1902680 3.05e-02
GO:0045893 3.05e-02
GO:0090575 4.97e-03
GO:0044798 5.82e-03
GO:0005923 6.95e-03
GO:0070160 7.09e-03
GO:0005667 1.61e-02
GO:0005911 1.94e-02
GO:0030054 3.56e-02
GO:0004879 7.09e-03
GO:0098531 7.09e-03
GO:0003707 1.11e-02
GO:0003682 1.53e-02
GO:0000976 1.75e-02
GO:1990837 1.84e-02
GO:0003690 2.19e-02
GO:0044212 2.49e-02
GO:0000975 2.71e-02
GO:0001067 2.71e-02
KEGG Pathway Download
KO P value
ko04630 1.83e-02
ko04060 2.65e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG12636
ACAGGAAACTAAAAGAAGTTGACAATAAACGCCTTTTTTGCTCTCAATCATGTACTAAACTCCTTGACAT
GTAATCTGTCAATAGTTTGTAGCAGAGATAATGCCGGCTGCCACGAGTGAGGTTGATTGGCAGCTTGGCT
TGGCCCCTCCCTCCTGTGGTTTGACGGGGGGTAGGTGAGAGAATACAGAGCCGGCCCCTTCCTCGCCCGC
TCCTCCCTGCCTCTCTCTCTCTCTATCTCTATCTCACTCTCTCTCTTGCTCTTGGTCTACGGTTCTGCTC
CTGTACACACGCACACACACCAAGC