LncRNA Gene

ZFLNCG12688

Basic Information

Chromesome: chr23

Start: 32916483

End: 32916687

Transcript: ZFLNCT19578

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR065196 3 dpf normal 53.00
SRR1049952 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with gallein 52.99
SRR065197 3 dpf U1C knockout 28.82
SRR726540 5 dpf normal 26.69
SRR1205154 5dpf transgenic sqET20 26.23
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 22.95
SRR592698 pineal gland normal 22.02
SRR726541 5 dpf infection with Mycobacterium marinum 17.45
SRR516124 skin male and 3.5 year 17.24
SRR726542 5 dpf infection with control 16.24
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:171551 0.53
si:dkey-20i20.2 0.53
zgc:113176 0.53
nr5a1a 0.53
dckl1b 0.53
zdhhc14 0.53
parp6a 0.52
tmx4 0.52
zgc:174651 0.52
fgf17 0.51
Gene Ontology Download
GO P value
GO:2000253 2.13e-03
GO:0060259 3.55e-03
GO:1903225 5.67e-03
GO:0048520 5.67e-03
GO:0042664 5.67e-03
GO:0030325 6.38e-03
GO:0021854 7.09e-03
GO:2000542 7.79e-03
GO:0009996 7.79e-03
GO:0045992 8.50e-03
GO:0090575 2.46e-02
GO:0044798 2.88e-02
GO:0004949 1.42e-03
GO:0003756 8.50e-03
GO:0016864 8.50e-03
GO:0038023 1.20e-02
GO:0019706 1.34e-02
GO:0019707 1.76e-02
GO:0004872 1.85e-02
GO:0060089 1.85e-02
GO:0016409 1.90e-02
GO:0016417 1.97e-02
KEGG Pathway Download
KO P value
ko04015 4.34e-03
ko05218 3.50e-02
ko04391 3.70e-02
Conservation
Zebrafish lncRNA Transcript Human lncRNA Transcript Mouse lncRNA Transcript Methods
ZFLNCT19578 NONMMUT056240; Direct blastn
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG12688
ACATACCGAGCTGTTTTGGCACTGCACGCTGGAGCTGTTGAATCTGAGCGCCGTGACTCTGTGACTGACT
CCTTGAATGTGTAACACACACTCGTATCCGCGCTGCCCCGACTGAGGTTGTGGAAGGTTCCGAGCTTTCA
GGGTGATGGGCTTCACCTCTCCTGCTGGGATCAGGATCTCCTCAGAGCGCACCAGTTGAGGGCA