LncRNA Gene

ZFLNCG12757

Basic Information

Chromesome: chr23

Start: 38022357

End: 38022583

Transcript: ZFLNCT19708

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516124 skin male and 3.5 year 25.09
SRR941753 posterior pectoral fin normal 23.81
SRR516129 skin male and 5 month 23.14
SRR516123 skin male and 3.5 year 19.39
SRR941749 anterior pectoral fin normal 16.78
SRR516125 skin male and 3.5 year 14.88
SRR592702 pineal gland normal 14.65
SRR1299124 caudal fin Zero day time after treatment 14.42
SRR891512 blood normal 8.96
SRR942767 embryo myd88-/- and infection with Mycobacterium marinum 8.84
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC796271 0.62
LOC101886804 0.62
LOC101886877 0.61
tmprss13a 0.60
LOC100330638 0.59
LOC101882238 0.59
grp 0.59
LOC100538303 0.58
LOC100535301 0.58
LOC567640 0.58
Gene Ontology Download
GO P value
GO:0046457 2.63e-04
GO:0006693 2.63e-04
GO:0006692 2.63e-04
GO:0001516 2.63e-04
GO:0048884 6.53e-04
GO:0046456 1.16e-03
GO:1901570 1.16e-03
GO:0006636 1.42e-03
GO:0034314 2.67e-03
GO:0006807 4.94e-03
GO:0005911 5.19e-07
GO:0030054 4.79e-05
GO:0009986 2.14e-04
GO:0005737 4.31e-04
GO:0005922 5.96e-04
GO:0005921 9.92e-04
GO:0016021 1.58e-03
GO:0005923 2.08e-03
GO:0070160 2.20e-03
GO:0005885 2.32e-03
GO:0008116 5.19e-03
GO:0016595 1.03e-02
GO:0000981 1.21e-02
GO:0043565 1.33e-02
GO:0005198 1.39e-02
GO:0004666 1.55e-02
GO:0005114 1.55e-02
GO:0070273 1.55e-02
GO:0001158 2.06e-02
GO:0004252 2.19e-02
KEGG Pathway Download
KO P value
ko00590 1.60e-02
ko05205 1.74e-02
ko05217 2.65e-02
ko05140 3.17e-02
ko04390 3.23e-02
ko04370 3.33e-02
ko05200 3.36e-02
ko04512 3.49e-02
ko05222 4.34e-02
ko04974 4.97e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG12757
GATATTAAAGTGGTGTTTACACCATTTCTGCATTTTGAAATCTCGGCAACTGGAGCTGGAGCTGGAGGTT
TGTAGTACTCAGCATGTTGTTGCAGTGTTTACAGTGCTGATCCTATACTTCTGGGTTTCTTCCCACCCAG
CCTTGCTTTCGTGTTTTAAAATGGCGGGCTCATGAAATAAGCGGCGGATGTATGATAGGGCCCAGAGTAT
GTGTGAAACAGGCGCA