LncRNA Gene

ZFLNCG13206

Basic Information

Chromesome: chr24

Start: 40696951

End: 40697182

Transcript: ZFLNCT20497

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023146 head kidney normal 15.38
SRR1205154 5dpf transgenic sqET20 7.41
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 4.68
SRR891512 blood normal 4.22
SRR1205172 5dpf transgenic sqET20 and neomycin treated 5h 3.98
SRR1039573 gastrointestinal diet 0.75 NPM 2.73
SRR1569491 embryo normal 2.44
SRR1562529 intestine and pancreas normal 1.91
SRR516123 skin male and 3.5 year 1.90
SRR527834 head normal 1.88
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG13206
CCCCTTTAGAAATCTTTAGTGTGCATTTACTGAGTGATTAAGAGTTAAGAGCGTTTGAATCCACAGATAC
CGAGGCAGGTAAACACCAAGTCAATGACGTACAAACCCAAGTTAACATAAGTCATGAACGTGACCACAAA
CTGGATGCTCCATACGCAGCTGTTCCCAGGACAGTCTTTAGGCCGCGGGTTTCCTCTGAAGCTGTAGATC
GGCCACAGGATTGCTGCCGAA