LncRNA Gene

ZFLNCG13235

Basic Information

Chromesome: chr24

Start: 43119614

End: 43119840

Transcript: ZFLNCT20538

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516134 skin male and 5 month 114.75
SRR516131 skin male and 5 month 72.80
SRR516133 skin male and 5 month 70.66
SRR516130 skin male and 5 month 56.10
SRR516126 skin male and 5 month 49.00
SRR516127 skin male and 5 month 47.12
SRR516129 skin male and 5 month 41.94
SRR516132 skin male and 5 month 41.01
SRR516135 skin male and 5 month 20.73
SRR516122 skin male and 3.5 year 20.26
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100333914 0.60
si:dkey-7c18.24 0.58
si:ch73-97h19.2 0.57
zgc:172271 0.55
ponzr10 0.55
si:ch211-113j14.1 0.55
LOC100535149 0.55
loxl3a 0.54
LOC100005636 0.54
lox 0.54
Gene Ontology Download
GO P value
GO:1904893 2.09e-03
GO:0046426 2.09e-03
GO:0042996 2.27e-03
GO:0042998 2.27e-03
GO:1904377 2.27e-03
GO:0090003 2.27e-03
GO:1904375 2.27e-03
GO:0061444 2.27e-03
GO:1903076 2.27e-03
GO:1903078 2.27e-03
GO:0005578 1.33e-05
GO:0031012 2.64e-05
GO:0044421 3.00e-04
GO:0005576 3.96e-03
GO:0005581 6.90e-03
GO:0043226 8.04e-03
GO:0005634 1.05e-02
GO:0043229 1.26e-02
GO:0044464 2.13e-02
GO:0043227 3.09e-02
GO:0071253 2.27e-03
GO:0004860 3.70e-03
GO:0019210 3.70e-03
GO:0003865 9.07e-03
GO:0019887 1.13e-02
GO:0019207 1.25e-02
GO:0033765 1.81e-02
GO:0004716 1.81e-02
GO:0004497 2.67e-02
GO:0020037 2.67e-02
KEGG Pathway Download
KO P value
ko04974 5.95e-04
ko04672 1.93e-03
ko00120 3.55e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG13235
TTTAATTCAGCTGTACATGTTTGCCCTATAGGAAGAGCATATGAAAGGCTGAAGAAGCCTGAAAGTGTCC
TCTATTTGAGTGAAGCTCGGGTGTTGATGAAGTTCAGTTGATCAAGGATAATGTTGTGCTGGAACTGCCG
ATATCCGGTGACATTGAAGACGGGTTGTTCTCCAGGAATTTATATCCATCTTTAAACAGAACCTTGAGGA
TGTCCAGAACGACCAA