LncRNA Gene

ZFLNCG13270

Basic Information

Chromesome: chr25

Start: 1546117

End: 1546366

Transcript: ZFLNCT20601

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR891512 blood normal 5.11
SRR1205160 5dpf transgenic sqET20 and GFP+ 0.98
SRR535849 larvae normal 0.78
SRR1299125 caudal fin Half day time after treatment 0.69
SRR1299127 caudal fin Two days time after treatment 0.64
SRR1562533 testis normal 0.63
SRR1205169 5dpf transgenic sqET20 and neomycin treated 5h and GFP+ 0.52
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 0.42
SRR1562528 eye normal 0.40
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 0.34
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG13270
TTTCACTCCAAGAAGGCCAAACAACACATTCAAAAACCCCATAGAAAGTGTCGCACCGAATGAACAACAC
AGGAATGAACCGAGCGCATAGACTGACAATTGACAGTCAAATTCGTTGGGCAGAAATTTAAATGCGAAAG
CTCCTATTGTGACACCAGGAGCCGCGTAACATGCGAAAAGCACATCTGACCACGTCCTGATGCTGATAAT
CGACCCAAAAACCAGAGCTGAAGTCAAGAGTAATGCGAA