LncRNA Gene

ZFLNCG03008

Basic Information

Chromesome: chr5

Start: 396218

End: 396492

Transcript: ZFLNCT04600

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR519737 2 dpf VD3 treatment 72.75
SRR519717 2 dpf FETOH treatment 64.64
SRR519747 6 dpf VD3 treatment 30.67
SRR519727 6 dpf FETOH treatment 29.72
SRR519722 4 dpf FETOH treatment 28.32
SRR519742 4 dpf VD3 treatment 26.28
SRR519732 7 dpf FETOH treatment 25.94
SRR519752 7 dpf VD3 treatment 24.48
SRR038627 embryo control morpholino 18.52
SRR726542 5 dpf infection with control 18.00
Express in tissues
Correlated coding gene Download
gene correlation coefficent
dcc 0.79
celsr3 0.79
LOC100332164 0.79
LOC101885548 0.79
LOC572002 0.77
si:ch73-290k24.1 0.77
LOC101884459 0.76
cntn2 0.76
LOC100333401 0.75
ncanb 0.75
Gene Ontology Download
GO P value
GO:0009581 2.13e-11
GO:0009582 2.13e-11
GO:0007601 4.02e-11
GO:0097485 4.08e-11
GO:0034765 4.18e-11
GO:0050804 4.51e-11
GO:0023052 4.88e-11
GO:0007156 5.20e-11
GO:0006816 5.22e-11
GO:0099537 5.52e-11
GO:0008328 1.31e-11
GO:0098802 3.81e-11
GO:0043005 3.81e-11
GO:0043235 3.98e-11
GO:0098590 5.35e-11
GO:0034703 6.25e-11
GO:0045211 6.72e-11
GO:0045202 7.30e-11
GO:0098589 7.33e-11
GO:1902495 7.58e-11
GO:0008066 1.09e-11
GO:0005230 2.60e-11
GO:0009881 3.05e-11
GO:0030594 4.19e-11
GO:0022832 5.77e-11
GO:0005267 5.84e-11
GO:0022834 6.10e-11
GO:0015276 6.10e-11
GO:0005231 6.19e-11
GO:0005262 6.60e-11
KEGG Pathway Download
KO P value
ko04080 9.21e-29
ko04724 1.05e-25
ko05033 1.04e-23
ko04727 7.72e-19
ko05032 3.38e-17
ko04728 9.50e-17
ko04713 3.10e-15
ko04723 3.73e-14
ko04024 6.08e-13
ko04725 3.29e-12
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03008
TCCAGTGCTCCTCATCCGCCAGTCGGTGCAGCAGAAGCGGGTCCGTCAGCATGGAGCTCCGGGCTGCATA
ACGCACACATCCAGGACACACCGCGCTCTCCTACGCACAGATCTGCGGGATTGATTGACTGACTCCCTGC
CTGATTGATTGATTAGCAGCGGATTTCGCGCTCGTGTCGCTCCACCATGGGCTGCGTCACTGGAGATATT
CGCCGACTTTCCGCGCTCCTCATCGGGCTGCAGGTCCTCTACACACACGGTCAGTGCTGCTCAC