LncRNA Gene

ZFLNCG05167

Basic Information

Chromesome: chr8

Start: 24105824

End: 24106130

Transcript: ZFLNCT08010

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR514028 retina control morpholino 70.23
SRR800037 egg normal 40.75
SRR592703 pineal gland normal 29.78
ERR023143 swim bladder normal 19.51
ERR023144 brain normal 18.87
SRR1049952 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with gallein 16.97
SRR514030 retina id2a morpholino 15.14
SRR1565805 brain normal 14.25
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 13.82
SRR1205172 5dpf transgenic sqET20 and neomycin treated 5h 13.23
Express in tissues
Correlated coding gene Download
gene correlation coefficent
ephb2 0.72
si:dkey-80n10.2 0.71
kifap3b 0.70
akt3 0.69
fyna 0.69
khdrbs3 0.69
coro1b 0.69
LOC796115 0.69
LOC100331540 0.69
pcdh2ab8 0.68
Gene Ontology Download
GO P value
GO:0050804 1.15e-11
GO:0034762 2.99e-11
GO:0044700 4.30e-11
GO:0098655 4.94e-11
GO:0007267 5.59e-11
GO:0043269 7.28e-11
GO:0007268 7.39e-11
GO:0099536 7.39e-11
GO:0099537 7.39e-11
GO:0023052 7.89e-11
GO:0034702 4.06e-11
GO:0097060 4.19e-11
GO:1902495 4.45e-11
GO:0034703 4.59e-11
GO:0031410 5.59e-11
GO:0097708 5.59e-11
GO:1990351 7.00e-11
GO:0030054 7.31e-11
GO:0098589 8.21e-11
GO:0097458 8.54e-11
GO:0005230 2.17e-11
GO:0008066 2.35e-11
GO:0022843 2.40e-11
GO:0072509 3.20e-11
GO:0015085 3.71e-11
GO:0022836 4.51e-11
GO:0022832 4.84e-11
GO:0022834 5.70e-11
GO:0015276 5.70e-11
GO:0015077 6.81e-11
KEGG Pathway Download
KO P value
ko04724 8.46e-27
ko05033 2.04e-22
ko04727 3.33e-22
ko04728 8.79e-19
ko05032 1.66e-18
ko04723 1.03e-17
ko04713 7.50e-15
ko04721 7.87e-13
ko04080 2.10e-12
ko04725 1.19e-11
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05167
TGTACTTATATATGCTGAGCACTCTATATATAAAATCAAATTAGTGATCATTTATTACATATATTATACT
GTCAAAATAAGTGCACCCGTGTTCTTGTTCTTTGTCTTAATCTTTGTATTTATCATAATGTTTTTTGCTG
TGTTAAACATTAAGTCACTGCAGTCTTCCTTGAGAGCATTTATTCTTATTTATATGTATGCCCAAAATTA
GCTTGCCAAGTAGTACCTGACAAGTCTTAAATGCATGTCCATTTTGGCAGGTAACGTTATTTGGAATAGC
AGAACAATTTATGTTTTTATTTAAAC