LncRNA Gene

ZFLNCG06179

Basic Information

Chromesome: chr10

Start: 8787965

End: 8788188

Transcript: ZFLNCT09509

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1562529 intestine and pancreas normal 26.54
SRR941753 posterior pectoral fin normal 25.45
SRR516123 skin male and 3.5 year 24.50
SRR516121 skin male and 3.5 year 20.53
ERR023146 head kidney normal 17.08
SRR516122 skin male and 3.5 year 16.99
SRR941749 anterior pectoral fin normal 16.28
SRR516129 skin male and 5 month 16.10
SRR592703 pineal gland normal 15.99
SRR1562531 muscle normal 14.74
Express in tissues
Correlated coding gene Download
gene correlation coefficent
rfxank 0.69
mavs 0.68
LOC100538089 0.68
psme2 0.67
mhc1zba 0.67
zgc:171711 0.67
LOC101884500 0.67
zgc:174863 0.67
p2ry10 0.66
zgc:194655 0.66
Gene Ontology Download
GO P value
GO:0019882 6.20e-12
GO:0002252 8.45e-12
GO:0050778 1.19e-11
GO:0050776 1.24e-11
GO:0048002 2.02e-11
GO:0002474 2.02e-11
GO:0006952 2.11e-11
GO:0002684 2.12e-11
GO:0002757 2.33e-11
GO:0006955 4.11e-11
GO:0044446 1.63e-10
GO:0044422 2.32e-10
GO:0044424 4.11e-08
GO:0042611 1.66e-07
GO:0044428 3.94e-07
GO:0031234 6.17e-07
GO:0019897 1.07e-06
GO:0005634 2.38e-06
GO:0043226 3.52e-06
GO:0042612 4.99e-06
GO:0004896 2.10e-07
GO:0004715 1.78e-06
GO:0003676 5.61e-06
GO:0022892 1.51e-05
GO:0003950 2.70e-05
GO:0005215 5.03e-05
GO:0032813 5.10e-05
GO:0005164 5.10e-05
GO:0004175 5.87e-05
GO:0001637 6.47e-05
KEGG Pathway Download
KO P value
ko05340 2.88e-11
ko05164 2.03e-10
ko04650 6.11e-10
ko04060 3.33e-09
ko04612 6.93e-08
ko05162 1.25e-07
ko05168 1.51e-07
ko04621 2.87e-07
ko05133 3.39e-07
ko04380 6.34e-07
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06179
GAAGATGATAGGAACACTTCTTCACCCATATACGAGAATACAGAAAGTACCCCGCTGATTCACAGTGACG
ACTCAAGTGAAGGAGTCATACAAAGACAAGAAGATGTACCAAGACATGAAGACAAACTAAGACAAGCAGA
CAAACTAAGACAAGATGCTTGTTGTTTTTGTGGGGTTTGCTTCTTCTTTTGTTGTGGTTGGCTTTGTGAA
TGTAAACCTTATA