LncRNA Gene

ZFLNCG07878

Basic Information

Chromesome: chr14

Start: 1284532

End: 1284834

Transcript: ZFLNCT12083

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1647684 spleen SVCV treatment 6.76
ERR023143 swim bladder normal 6.06
SRR891512 blood normal 5.26
SRR516122 skin male and 3.5 year 4.51
SRR516125 skin male and 3.5 year 3.92
ERR023145 heart normal 3.80
ERR023146 head kidney normal 3.71
SRR592701 pineal gland normal 3.44
SRR592699 pineal gland normal 3.11
SRR516129 skin male and 5 month 2.75
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-21e2.12 0.64
LOC101887143 0.62
LOC100329837 0.62
si:ch211-214p13.9 0.60
si:ch211-171h4.5 0.60
LOC101883059 0.60
LOC100537088 0.60
si:ch211-147j13.3 0.60
ptprc 0.59
LOC100003350 0.59
Gene Ontology Download
GO P value
GO:0019882 5.61e-12
GO:0002757 6.24e-12
GO:0002252 1.05e-11
GO:0009607 1.19e-11
GO:0002764 1.24e-11
GO:0050778 1.38e-11
GO:0045087 1.91e-11
GO:0006955 3.53e-11
GO:0050776 4.07e-11
GO:0002684 6.11e-11
GO:0044425 1.70e-08
GO:0044424 2.19e-08
GO:0044422 2.35e-07
GO:0044446 3.44e-07
GO:0043226 7.28e-07
GO:0009897 8.77e-07
GO:0031234 9.50e-07
GO:0043227 1.00e-06
GO:0043231 1.38e-06
GO:0098552 1.41e-06
GO:0003674 1.92e-07
GO:0004715 2.16e-06
GO:0005102 1.50e-05
GO:0004896 3.51e-05
GO:0003676 7.83e-05
GO:0004888 1.44e-04
GO:0003823 1.51e-04
GO:0043169 2.20e-04
GO:0042287 2.75e-04
GO:0042289 2.75e-04
KEGG Pathway Download
KO P value
ko05340 1.32e-15
ko04060 3.55e-13
ko04650 1.45e-11
ko05330 1.83e-10
ko04612 9.78e-10
ko05152 6.52e-09
ko05140 8.45e-09
ko05332 1.59e-08
ko04380 1.70e-08
ko04660 4.71e-08
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG07878
GTGTACATTCATAGCAATGCAATGTATAACGGTGTAAAAATACTGATCAGTTTCATATCAATGCAGAGTG
GCACGTAATAGAAACAGACCATCTAAAATCTGTTATTCCCTGAAGGTTTAGTCTAGAAATAGCTTTTTTT
AGTTGTTCCCTGCAGTGGTCTGGAGAAGGTCAGTCTGCTTCACTTTCTTTCTGCCTCCATTCGTTCATCC
AGATTTTTGACGTTCTTCAGGAACGTCATGACGTCGGTTGCCTCGTATTCCTCACATGTTCTGCATTCGC
ACTTTCGGTTCGGGCAAGGCTT