LncRNA Gene

ZFLNCG09108

Basic Information

Chromesome: chr16

Start: 31452663

End: 31452870

Transcript: ZFLNCT14010

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023144 brain normal 66.22
SRR1569495 embryo normal 46.89
SRR535978 larvae normal 44.79
SRR592702 pineal gland normal 42.62
SRR1205166 5dpf transgenic sqET20 and neomycin treated 3h 42.56
SRR592701 pineal gland normal 41.02
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 33.97
SRR1028002 head normal 33.09
SRR1028004 head normal 33.07
SRR1205154 5dpf transgenic sqET20 31.54
Express in tissues
Correlated coding gene Download
gene correlation coefficent
mpp2a 0.75
lhx9 0.73
LOC561242 0.73
fsd1 0.73
kctd6a 0.73
LOC101882731 0.73
etv1 0.73
sept5b 0.73
cyfip2 0.72
coro1b 0.72
Gene Ontology Download
GO P value
GO:0007270 8.99e-12
GO:0043269 4.45e-11
GO:0098662 5.88e-11
GO:0050804 5.94e-11
GO:0034765 6.26e-11
GO:0097485 6.43e-11
GO:0006836 7.44e-11
GO:0007156 8.12e-11
GO:0023052 8.21e-11
GO:0099537 8.41e-11
GO:0008328 1.68e-11
GO:0097060 2.21e-11
GO:0044456 3.99e-11
GO:0097458 4.19e-11
GO:0031410 4.21e-11
GO:0097708 4.21e-11
GO:0031982 4.24e-11
GO:0099503 4.25e-11
GO:0034702 5.07e-11
GO:0043005 5.48e-11
GO:0008066 1.38e-11
GO:0005234 1.70e-11
GO:0019905 2.92e-11
GO:0030276 2.98e-11
GO:0015079 3.60e-11
GO:0005230 3.71e-11
GO:0005244 3.99e-11
GO:0030594 5.86e-11
GO:0005231 8.48e-11
GO:0005267 8.61e-11
KEGG Pathway Download
KO P value
ko04080 2.57e-29
ko04724 1.60e-26
ko05033 3.03e-26
ko04727 1.17e-19
ko05032 8.16e-19
ko04728 1.01e-18
ko04721 2.39e-17
ko04713 6.40e-16
ko04723 9.43e-15
ko04725 2.09e-13
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG09108
TGCTGCCCCATAAATATGGATGAATGTTTGATCAGCTTAATCACCCGCACGCCTCATGTTGCTTGTCTAA
GCCACGTGGAGTGACTAAACTCTAGAGTTCTCTGGGTTTAGGTTGTGTCACATGCCTCTTCTTTGCTTCA
GTTCCATGTTGTACCAAGCACAGAAACACTGTCAACTCCGGCCTTAATCTCTTAACCTGGCACTCAC