LncRNA Gene

ZFLNCG12488

Basic Information

Chromesome: chr23

Start: 17522277

End: 17522536

Transcript: ZFLNCT19299

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1648856 brain normal 125.13
SRR372802 5 dpf normal 95.61
ERR023144 brain normal 76.89
ERR023146 head kidney normal 53.35
SRR1648854 brain normal 47.47
SRR1562529 intestine and pancreas normal 42.97
SRR700534 heart control morpholino 32.92
SRR1188148 embryo Control PBS 0.5 hpi 30.89
SRR1205172 5dpf transgenic sqET20 and neomycin treated 5h 30.81
SRR1291417 5 dpi injected marinum 30.69
Express in tissues
Correlated coding gene Download
gene correlation coefficent
hsbp1a 0.75
gnao1b 0.75
islr2 0.73
pbx3b 0.73
gng3 0.72
zgc:100906 0.72
lrrtm1 0.72
pcdh1g29 0.72
cnrip1a 0.72
rnft2 0.72
Gene Ontology Download
GO P value
GO:0007218 1.79e-11
GO:0007268 3.03e-11
GO:0099536 3.03e-11
GO:0099537 3.03e-11
GO:0023052 4.41e-11
GO:0015672 5.01e-11
GO:0007601 5.58e-11
GO:0007267 6.16e-11
GO:0044700 7.89e-11
GO:0050953 8.97e-11
GO:0032281 1.46e-11
GO:0043005 3.63e-11
GO:0044456 3.88e-11
GO:1990351 4.46e-11
GO:0034702 5.35e-11
GO:0008328 5.91e-11
GO:0098589 6.12e-11
GO:0034703 6.40e-11
GO:0042995 7.17e-11
GO:0097060 8.05e-11
GO:0022835 2.26e-11
GO:0022824 2.26e-11
GO:0005230 2.75e-11
GO:0022834 3.12e-11
GO:0015276 3.12e-11
GO:0019905 3.39e-11
GO:0005244 3.88e-11
GO:0022843 3.98e-11
GO:0030594 5.26e-11
GO:0030276 5.93e-11
KEGG Pathway Download
KO P value
ko04080 2.42e-25
ko04721 3.91e-24
ko04724 7.43e-21
ko05033 2.45e-19
ko04727 1.45e-16
ko04728 2.45e-16
ko05032 9.15e-16
ko04723 3.12e-14
ko04713 1.55e-13
ko04911 3.77e-11
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG12488
TTTAATTCTTTAGAAAAGTGTTGATACATACATATGTGAAGAAACTGAACGATTGAATGAAAACGAAGAC
TAAAAAATGGATTTTTGTTGTTTAATTCAAAACAGCATGGGCGGCTCCTAACATATCACTTTCATTAATG
AAAACCAATGATTTGAGATGAAGCTTTCTCCAATGGGATGTCACTGCTGAAATGACATTGTGACTTTTTT
TTTCTCCCAAGCTGTACGTCACAAAGCTAAATATACTAATAAAACCGTG