LncRNA Gene

ZFLNCG12740

Basic Information

Chromesome: chr23

Start: 36539155

End: 36539565

Transcript: ZFLNCT19674

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR592701 pineal gland normal 24.87
SRR957181 heart normal 23.20
SRR957180 heart 7 days after heart tip amputation 18.97
SRR800045 muscle normal 17.18
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 16.49
SRR516124 skin male and 3.5 year 13.05
SRR592703 pineal gland normal 12.23
ERR145648 skeletal muscle 27 degree_C to 27 degree_C 11.35
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 11.35
SRR516125 skin male and 3.5 year 11.24
Express in tissues
Correlated coding gene Download
gene correlation coefficent
nr3c1 0.81
mbnl3 0.79
reep3a 0.79
b2ml 0.78
si:ch73-52p7.1 0.78
si:dkeyp-23e4.3 0.78
c1qtnf1 0.78
zgc:158309 0.77
zgc:123248 0.77
zgc:91944 0.77
Gene Ontology Download
GO P value
GO:0002684 3.61e-11
GO:0002682 3.74e-11
GO:0050778 3.79e-11
GO:0006952 4.32e-11
GO:0002253 4.70e-11
GO:0002376 6.19e-11
GO:0006396 1.01e-10
GO:0006955 1.05e-10
GO:0050776 1.15e-10
GO:0071840 4.18e-10
GO:0044428 2.18e-10
GO:0044446 3.71e-10
GO:0044422 3.80e-10
GO:0032991 6.26e-10
GO:0044424 8.18e-10
GO:1990904 1.89e-09
GO:0030529 1.89e-09
GO:0044464 4.64e-08
GO:0043226 1.08e-07
GO:0043229 1.35e-07
GO:0003676 1.20e-08
GO:0003723 3.72e-07
GO:0005520 5.08e-07
GO:0003707 1.36e-05
GO:0019838 1.82e-05
GO:0004896 3.37e-05
GO:0008236 1.21e-04
GO:0017171 1.21e-04
GO:0016491 1.30e-04
GO:0004252 2.05e-04
KEGG Pathway Download
KO P value
ko04060 8.97e-10
ko04380 1.10e-07
ko05340 2.63e-07
ko04610 1.15e-06
ko05321 7.94e-06
ko04658 9.21e-06
ko05034 2.06e-05
ko04650 3.67e-05
ko04659 4.79e-05
ko03040 9.44e-05
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG12740
AAAAATTTAGACTGAAAATTCTAATGAAAGTCTATGAGAAGGTGCATTTCTTAGCACAACACTGGCAAAC
TCGCAAACTGGCGACCAGGTGGGCATGTTGAGCGATGCAACAAAGTTGAGAATCCTTGAACTTTATGCAA
ATGAAGAGTGACTTTCTTGAGCGACAGCCAATAGGAGCACAAGCAGAGCTCCCGTAATCTTCTCTCAGAT
CCTGCAGAGGCCAGTTGTAGTCTCTGTGCTGTATACCTACACAGACCTGCGTTTGCAGCAAATCACCACC
CAGAGCGACAGGCAGCTACAAAGCTGCGGCTAGTGTGAATGAGGCATGCACTATAAGTCAAATACTAGTG
TCTTGTAAAATAGTATGTACTTCATCTCAAGGACAAAATAAATTAGTTATTAAAAATAAA