LncRNA Gene

ZFLNCG13398

Basic Information

Chromesome: chr25

Start: 13379806

End: 13380093

Transcript: ZFLNCT20824

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1299129 caudal fin Seven days time after treatment 26.94
SRR1299128 caudal fin Three days time after treatment 24.33
SRR1049952 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with gallein 23.94
SRR1648856 brain normal 17.86
SRR1299127 caudal fin Two days time after treatment 17.13
SRR1299124 caudal fin Zero day time after treatment 15.43
ERR023143 swim bladder normal 14.21
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 14.09
SRR516128 skin male and 5 month 13.86
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 13.52
Express in tissues
Correlated coding gene Download
gene correlation coefficent
il15 0.66
LOC556502 0.66
apol1 0.66
zgc:77517 0.65
lifrb 0.64
nfkbiaa 0.64
zgc:172145 0.62
prkag2b 0.62
zgc:123218 0.62
kcnj2a 0.62
Gene Ontology Download
GO P value
GO:0002376 1.01e-06
GO:0006955 9.20e-06
GO:0043207 9.34e-06
GO:0009607 1.24e-05
GO:0019221 2.90e-05
GO:0034097 5.62e-05
GO:0046627 1.35e-04
GO:1900077 1.35e-04
GO:0006952 1.95e-04
GO:0051707 2.97e-04
GO:0044424 6.03e-05
GO:0044444 1.23e-04
GO:0043229 1.39e-04
GO:0043226 2.00e-04
GO:0044422 2.07e-04
GO:0044446 2.76e-04
GO:0043231 3.26e-04
GO:0044421 3.74e-04
GO:0044464 5.90e-04
GO:0043227 6.16e-04
GO:0004857 2.16e-04
GO:0019838 2.52e-04
GO:0005520 8.37e-04
GO:0030234 1.58e-03
GO:0003824 1.62e-03
GO:0004896 3.07e-03
GO:0061135 3.19e-03
GO:0001071 3.36e-03
GO:0003700 3.36e-03
GO:0004860 3.70e-03
KEGG Pathway Download
KO P value
ko04668 3.65e-11
ko04380 1.99e-10
ko05164 5.33e-09
ko04621 1.74e-08
ko04660 4.49e-07
ko04623 2.80e-06
ko05168 4.69e-06
ko04060 7.97e-06
ko05161 1.50e-05
ko05162 1.65e-05
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG13398
GCCCAAAAGTATTGAAAGCCTCATGGGAAAAAGCATGTTTAGCCAGTAGATGCCATTCCATTGCCATTGT
CGAATGTGTTTCAAAACAAATTGTGATATTTATTATCTGTGTTCATTTGGTTGAACATTTATGTTTAAAT
GACAACTATCTTGAGGCTGCTGGCTATGCATGTTGCCTGATTGTGAATTATTACATGCTGTATGTATTAT
GTTTGGTATTGTCGCAGGAGAGCTTTTGACCTAAATCGACAATGCTGATGCAGCCATGTTTGTATTCTGA
GGTGAAT